After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain CD146/MCAM expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human MCAM Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_006500.2
Taille du ADNc:1941bp
Description du ADNc:Full length Clone DNA of Homo sapiens melanoma cell adhesion molecule with N terminal His tag.
Synonyme du gène:MCAM, CD146, MUC18
Espèces:Human
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein belonging to the immunoglobulin superfamily. CD146 contains the characteristic immunoglobulin-like domains (V-V-C2-C2-C2), a transmembrane region and a short cytoplasmic tail. The CD146 expression is detected in endothelial cells in vascular tissue throughout the body, and plays a role in cell adhesion, as well as in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. As a Ca2+-independent cell adhesion molecule involved in heterophilic cell to cell interactions and a surface receptor, CD146 triggers tyrosine phosphorylation of FYN and PTK2 and subsequently induced signal transduction, proteolysis, or immune recognition. This protein is also expressed predominantly on metastatic lesions and advanced primary tumours, and thus has been suggested to play an important role in tumour progression and the development of metastasis in certain human carcinomas.

Références
  • Mills L, et al. (2002) Fully human antibodies to MCAM/MUC18 inhibit tumor growth and metastasis of human melanoma. Cancer Res. 62(17): 5106-14.
  • Taira E, et al. (2004) Characterization of Gicerin/MUC18/CD146 in the rat nervous system. J Cell Physiol. 198(3): 377-87.
  • Fritzsche FR, et al. (2008) CD146 protein in prostate cancer: revisited with two different antibodies. Pathology. 40(5): 457-64.
  • Bidlingmaier S, et al. (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res. 69(4): 1570-7.
  • Boneberg EM, et al. (2009) Soluble CD146 is generated by ectodomain shedding of membrane CD146 in a calcium-induced, matrix metalloprotease-dependent process. Microvasc Res. 78(3): 325-31.
  • Size / Price
    Catalogue : HG10115-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »