After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain IGF1R/CD221/IGF-I R expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IGF1R Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000875.3
Taille du ADNc:4104bp
Description du ADNc:Full length Clone DNA of Homo sapiens insulin-like growth factor 1 receptor with N terminal Myc tag.
Synonyme du gène:IGF1R, CD221, IGFIR, JTK13, MGC18216, MGC142170, MGC142172
Espèces:Human
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

The insulin-like growth factor-1 receptor (IGF1R) is a transmembrane tyrosine kinase involved in several biological processes including cell proliferation, differentiation, DNA repair, and cell survival. This a disulfide-linked heterotetrameric transmembrane protein consisting of two α and two β subunits, and among which, the α subunit is extracellular while the β subunit has an extracellular domain, a transmembrane domain and a cytoplasmic tyrosine kinase domain. IGF1R signalling pathway is activated in the mammalian nervous system from early developmental stages. Its major effect on developing neural cells is to promote their growth and survival. This pathway can integrate its action with signalling pathways of growth and morphogenetic factors that induce cell fate specification and selective expansion of specified neural cell subsets. Modulation of cell migration is another possible role that IGF1R activation may play in neurogenesis. In the mature brain, IGF-I binding sites have been found in different regions of the brain, and multiple reports confirmed a strong neuroprotective action of the IGF-IR against different pro-apoptotic insults. IGF1R is an important signaling molecule in cancer cells and plays an essential role in the establishment and maintenance of the transformed phenotype. Inhibition of IGF1R signaling thus appears to be a promising strategy to interfere with the growth and survival of cancer cells. IGF1R is frequently overexpressed by tumours, and mediates proliferation and apoptosis protection. IGF signalling also influences hypoxia signalling, protease secretion, tumour cell motility and adhesion, and thus can affect the propensity for invasion and metastasis. Therefore, the IGF1R is now an attractive anti-cancer treatment target.

Références
  • Bhr C, et al. (2004) The insulin like growth factor-1 receptor (IGF-1R) as a drug target: novel approaches to cancer therapy. Growth Horm IGF Res. 14 (4): 287-95.
  • Riedemann J, et al. (2006) IGF1R signalling and its inhibition. Endocr Relat Cancer. 13 Suppl 1: 33-43.
  • Gualco E, et al. (2009) IGF-IR in neuroprotection and brain tumors. Front Biosci. 14: 352-75.
  • Annenkov A. (2009) The insulin-like growth factor (IGF) receptor type 1 (IGF1R) as an essential component of the signalling network regulating neurogenesis. Mol Neurobiol. 40 (3): 195-215.
  • Size / Price
    Catalogue : HG10164-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »