Commande rapide

Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone

  • Human CD276 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain CD276 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001024736.1
Taille du ADNc:1605bp
Description du ADNc:Full length Clone DNA of Homo sapiens CD276 molecule transcript variant 1.
Synonyme du gène:B7H3, B7-H3, CD276
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-CD276
Site de restriction:KpnI + XbaI (6.1kb + 1.61kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CD276 qPCR primers for gene expression analysis, HP100093 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain CD276 Gene Plasmid Map
Human CD276 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11188-ACGCHF290
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11188-ACRCHF290
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11188-CFCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11188-CHCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11188-CMCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11188-CYCHF260
Humain B7-H3/CD276 transcript variant 1 Gène ADNc clone le vecteur de clonageHG11188-MCHF90
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11188-M-FCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11188-NFCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11188-NHCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11188-NMCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11188-NYCHF260
Humain B7-H3/CD276 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11188-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to attenuate peripheral immune responses through co-inhibition. It plays an important role in adaptive immune responses, and was shown to either promote or inhibit T-cell responses in various experimental systems. B7-H3 may play an important role in muscle-immune interactions, providing further evidence of the active role of muscle cells in local immunoregulatory processes. B7-H3 is a novel protein structurally related to the B7 family of ligands by the presence of a single set of immunoglobulin-V-like and immunoglobulin-C-like (VC) domains. Previous studies have correlated its overexpression with poor prognosis and decreased tumor-infiltrating lymphocytes in various carcinomas including uterine endometrioid carcinomas, and mounting evidence supports an immuno-inhibitory role in ovarian cancer prognosis. Recently, B7-H3 expression has been reported in several human cancers indicating an additional function of B7-H3 as a regulator of antitumor immunity.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Références
  • Suh WK, et al. (2004) The immune regulatory protein B7-H3 promotes osteoblast differentiation and bone mineralization. Proc Natl Acad Sci U S A. 101(35): 12969-73.
  • Waschbisch A, et al. (2008) Human muscle cells express the costimulatory molecule B7-H3, which modulates muscle-immune interactions. Arthritis Rheum. 58(11): 3600-8.
  • Loos M, et al. (2010) B7-h3 and its role in antitumor immunity. Clin Dev Immunol. 2010: 683875.
  • Zang X, et al. (2010) Tumor associated endothelial expression of B7-H3 predicts survival in ovarian carcinomas. Mod Pathol. 23(8): 1104-12.
  • Sun J, et al. (2010) Clinical significance and regulation of the costimulatory molecule B7-H3 in human colorectal carcinoma. Cancer Immunol Immunother. 59(8): 1163-71.
  • Size / Price
    Catalogue : HG11188-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »