CD300LD cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

CD300LD cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Human CD300 molecule-like family member d with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD300LD cDNA ORF Clone, Human, C-His tag: Alternative Names

CD300D cDNA ORF Clone, Human; CLM-4 cDNA ORF Clone, Human; CMRF35-A4 cDNA ORF Clone, Human; CMRF35A4 cDNA ORF Clone, Human

CD300LD Background Information

Full Name
CD300 molecule-like family member d
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait