CD30L cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

CD30L cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
705 bp
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 8 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD30L cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CD153 cDNA ORF Clone, Human; CD30L cDNA ORF Clone, Human; CD30LG cDNA ORF Clone, Human

CD30L Background Information

CD3 ligand (CD3L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and TNFR superfamily, and is a specific ligand for CD3/TNFRSF8 originally described as a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. CD3L is a type-II membrane glycoprotein expressed on activated T cells, stimulated monocyte-macrophages, granulocytes, eosinophils, and some Burkitt-like lymphoma cell lines. CD3L is capable of transducing signals through CD3 on different CD3+ lymphoma cell lines, and mediates pleiotropic biologic effects including cell proliferation, activation, differentiation, as well as cell death by apoptosis. CD3-CD3 ligand interaction has been suggested to have a pathophysiologic role in malignant lymphomas, particularly Hodgkin disease, large cell anaplastic lymphomas and Burkitt lymphomas, and is also involved in activation and functioning of the T cell-dependent immune response. Thus, CD153 and its receptor CD3 are regarded as therapeutic targets in hematologic malignancies, autoimmune and inflammatory diseases.
Full Name
tumor necrosis factor (ligand) superfamily, member 8
Research Areas
References
  • Hargreaves PG, et al. (2002) Soluble CD30 binds to CD153 with high affinity and blocks transmembrane signaling by CD30. Eur J Immunol. 32(1): 163-73.
  • Blazar BR, et al. (2004) CD30/CD30 ligand (CD153) interaction regulates CD4+ T cell-mediated graft-versus-host disease. J Immunol. 173(5): 2933-41.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Adv Exp Med Biol. 647: 174-85.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait