Commande rapide

Humain CD34 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain CD34 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_001773.2
    Taille du ADNc:987bp
    Description du ADNc:Full length Clone DNA of Homo sapiens CD34 molecule, transcript variant 2 with N terminal His tag.
    Synonyme du gène:CD34
    Espèces:Human
    Vecteur:pCMV3-SP-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD34 qPCR primers for gene expression analysis, HP100178 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humain CD34 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Product nameProduct name
    Fond

    Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

    Références
  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.
  • Size / Price
    Catalogue : HG10097-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »