After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human PTPRC Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_080921.2
Taille du ADNc:3432bp
Description du ADNc:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, receptor type C, transcript variant 2 with N terminal His tag.
Synonyme du gène:RTPRC, LCA, LY5, B220, CD45, T200, CD45R, GP180
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:pCMV3-His-PTPRC
Site de restriction:KpnI + XbaI (6kb + 3.48kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human PTPRC Gene Plasmid Map
Human CD45 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10086-ACGCHF390
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10086-ACRCHF390
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10086-CFCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10086-CHCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10086-CMCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10086-CYCHF350
Humain CD45/PTPRC transcript variant 2 Gène ADNc clone le vecteur de clonageHG10086-MCHF90
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG10086-M-NCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10086-NFCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10086-NHCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10086-NMCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10086-NYCHF350
Humain CD45/PTPRC transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG10086-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

Références
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Size / Price
    Catalogue : HG10086-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human CD45 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »