After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CDK1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001786.4
Taille du ADNc:894bp
Description du ADNc:Full length Clone DNA of Homo sapiens cell division cycle 2, G1 to S and G2 to M transcript variant 1 with N terminal His tag.
Synonyme du gène:CDK1, CDC28A, MGC111195, DKFZp686L20222, CDC2
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10739-ACGCHF270
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10739-ACRCHF270
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10739-ANGCHF270
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10739-ANRCHF270
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10739-CFCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10739-CHCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10739-CMCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10739-CYCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 Gène ADNc clone le vecteur de clonageHG10739-MCHF90
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10739-M-FCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10739-M-NCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10739-NFCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10739-NHCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10739-NMCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10739-NYCHF230
Humain CDC2 Kinase / CDK1 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10739-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

Références
  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.
  •  

    Size / Price
    Catalogue : HG10739-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »