Commande rapide

Humain CDC27 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain CDC27 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC011656
    Taille du ADNc:2493bp
    Description du ADNc:Full length Clone DNA of Homo sapiens cell division cycle 27 with N terminal His tag.
    Synonyme du gène:APC3, HNUC, NUC2, ANAPC3, CDC27Hs, D0S1430E, D17S978E
    Espèces:Human
    Vecteur:pCMV3-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CDC27 qPCR primers for gene expression analysis, HP104557 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Fond

    Cdc27, a component of the anaphase-promoting complex (APC/C), as a novel binding partner of MCPH1. APC/C is an E3 ubiquitin ligase that controls the cell cycle. A combination of in vitro and in vivo experiments revealed that the interaction between MCPH1 and Cdc27 is dependent on the phosphorylation of Cdc27 and is mediated by the C-terminal BRCT domains of MCPH1.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Références
  • Singh N, Wiltshire TD, Thompson JR, Mer G, Couch FJ. Molecular Basis for the Association of Microcephalin (MCPH1) Protein with the Cell Division Cycle Protein 27 (Cdc27) Subunit of the Anaphase-promoting Complex. The Journal of Biological Chemistry. 2012;287(4):2854-2862.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »