Commande rapide

Humain CDH13 / Cadherin-13 / H Cadherin expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CDH13 Informations sur les produits clonés de cDNA
Taille du ADNc:2142bp
Description du ADNc:Full length Clone DNA of Homo sapiens cadherin 13,H-cadherin(heart) with C terminal Myc tag.
Synonyme du gène:CDHH,
Site de restriction:KpnI+XbaI (6kb+2.19kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2076A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human CDH13 Gene Plasmid Map
Human CDH13 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain CDH13 / Cadherin-13 / H Cadherin expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Product nameProduct name

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Catalogue : HG11249-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.