Commande rapide

Text Size:AAA

Humain CEP70 expression plasmide de Gène l'ADNc ORF clone

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain CEP70 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC016050
Taille du ADNc:639bp
Description du ADNc:Full length Clone DNA of Homo sapiens centrosomal protein 70kDA.
Synonyme du gène:BITE, FLJ13036, CEP70
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-CEP70
Site de restriction:KpnI + XbaI(6.1kb+0.64kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CEP70 qPCR primers for gene expression analysis, HP102885 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »