Commande rapide

Humain CES3/Carboxylesterase 3 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CES3 Informations sur les produits clonés de cDNA
Taille du ADNc:1716bp
Description du ADNc:Full length Clone DNA of Homo sapiens carboxylesterase 3 with C terminal His tag.
Synonyme du gène:ES31, FLJ21736, CES3
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain CES3/Carboxylesterase 3 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name

Carboxylesterases hydrolyze esters of short-chain fatty acids and have roles in animals ranging from signal transduction to xenobiotic detoxification. In enzymology, a carboxylesterase is an enzyme that catalyzes the chemical reaction: a carboxylic ester + H2O = an alcohol + a carboxylate. Most enzymes from this group belong to the superfamily of hydrolases with alpha/beta protein fold (so called Alpha/beta hydrolase fold), specifically those acting on carboxylic ester bonds. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases. Carboxylesterase 3, also known as Liver carboxylesterase 31 homolog and CES3, is a endoplasmic reticulum lumen which belongs to the type-B carboxylesterase/lipase family. CES3 is involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. CES3 shows low catalytic efficiency for hydrolysis of CPT-11, a prodrug for camptothecin used in cancer therapeutics. CES3 is expressed in liver, colon and small intestine.

  • Augusteyn RC. et al.,1969, Biochim Biophys Acta. 171 (1): 128-37.
  • Saito S. et al., 2003, J. Hum. Genet. 48: 249-70.
  • Sanghani SP. et al., 2003, Clin Cancer Res. 9: 4983-91.
  • Sanghani SP. et al., 2004, Drug Metab Dispos. 32: 505-11.
  • Chen R. et al., 2009, J Proteome Res. 8: 651-61.
  • Size / Price
    Catalogue : HG11129-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.