After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain CFL1 / cofilin expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CFL1 Informations sur les produits clonés de cDNA
Taille du ADNc:501bp
Description du ADNc:Full length Clone DNA of Homo sapiens cofilin 1 (non-muscle) with N terminal Flag tag.
Synonyme du gène:CFL
Site de restriction:KpnI + XbaI (6kb + 0.55kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human CFL1 Gene Plasmid Map
Human CFL1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain CFL1 / cofilin expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Product nameProduct name

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.

  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.
  • Size / Price
    Catalogue : HG14544-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human CFL1 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.