Commande rapide

Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain CFLAR Informations sur les produits clonés de cDNA
Taille du ADNc:1443bp
Description du ADNc:Full length Clone DNA of Homo sapiens CASP8 and FADD-like apoptosis regulator transcript variant 1 with C terminal His tag.
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with CFLAR qPCR primers for gene expression analysis, HP101025 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11110-ACGCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11110-ACRCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11110-ANGCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11110-ANRCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11110-CFCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11110-CHCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11110-CMCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11110-CYCHF230
Humain c-FLIP/FLIP transcript variant 1 Gène ADNc clone le vecteur de clonageHG11110-MCHF90
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11110-M-FCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11110-NFCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11110-NHCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11110-NMCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11110-NYCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11110-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11110-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.