After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CFLAR Informations sur les produits clonés de cDNA
Taille du ADNc:1443bp
Description du ADNc:Full length Clone DNA of Homo sapiens CASP8 and FADD-like apoptosis regulator transcript variant 1 with C terminal His tag.
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11110-ACGCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11110-ACRCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11110-ANGCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11110-ANRCHF270
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11110-CFCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11110-CHCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11110-CMCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11110-CYCHF230
Humain c-FLIP/FLIP transcript variant 1 Gène ADNc clone le vecteur de clonageHG11110-MCHF90
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11110-M-FCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11110-NFCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11110-NHCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11110-NMCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11110-NYCHF230
Humain c-FLIP/FLIP transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG11110-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11110-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.