Commande rapide

Text Size:AAA

Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain CHAT Informations sur les produits clonés de cDNA
Taille du ADNc:1893bp
Description du ADNc:Full length Clone DNA of Homo sapiens choline O-acetyltransferase with C terminal His tag.
Synonyme du gène:CMS1A, CMS1A2, CHOACTASE
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with CHAT qPCR primers for gene expression analysis, HP104341 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15748-ACGCHF290
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15748-ACRCHF290
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15748-ANGCHF290
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15748-ANRCHF290
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15748-CFCHF260
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15748-CHCHF260
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15748-CMCHF260
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15748-CYCHF260
Humain Choline Acetyltransferase Gène ADNc clone le vecteur de clonageHG15748-GCHF90
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15748-NFCHF260
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15748-NHCHF260
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15748-NMCHF260
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15748-NYCHF260
Humain Choline Acetyltransferase expression plasmide de Gène l'ADNc ORF cloneHG15748-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG15748-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.