CHD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

CHD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
5169 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chromodomain helicase DNA binding protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+5.17kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CHD1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

CHD1 Background Information

The protein CHD1 is a member of the family of ATPase-dependent chromatin remodeling factors. CHD1, which recognizes trimethylated histone H3 lysine 4, has been implicated in transcriptional activation in organisms ranging from yeast to humans. The conserved chromatin remodeling and assembly factor CHD1 (chromodomains, helicase, DNA-binding domain) is present at active genes where it participates in histone turnover and recycling during transcription. CHD family member, CHD1 protein, also interacts with the influenza virus polymerase complex. CHD1 recognizes the H3K4me3 (histone 3 with a trimethyl group in lysine 4) histone modification, a hallmark of active chromatin. Downregulation of CHD1 causes a reduction in viral polymerase activity, viral RNA transcription, and the production of infectious particles. CHD1 associated with RNAP II and paralleled its degradation during infection with viruses that induce full or reduced degradation. Chromodomain helicase DNA-binding protein 1 (CHD1) is an ATP-dependent chromatin remodelling protein that is conserved throughout eukaryotes and has an ability to assemble and organise nucleosomes both in vitro and in vivo. The CHD1 gene, encoding the chromo-domain helicase DNA-binding protein-1, is one of the most frequently deleted genes in prostate cancer.
Full Name
chromodomain helicase DNA binding protein 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait