After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain CHL1/LICAM2/CALL expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CHL1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_006614.2
Taille du ADNc:3675bp
Description du ADNc:Full length Clone DNA of Homo sapiens CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) with N terminal Myc tag.
Synonyme du gène:CHL1, CALL, L1CAM2, FLJ44930, MGC132578
Espèces:Human
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:HindIII + XhoI
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member of the CTF / NF-1 family of transcription factors that serve as a novel calcium signaling pathway-responsive transcription factor and is considered as a member of the largest ctf complementation group, consisting of 30 of 126 ctf mutants isolated. CHL1 is a cell adhesion molecule highly related to L1. It contains structure plan of six extracellular C2-type immunoglobulin (Ig) domains followed by five fibronectin typeⅢ domains linked by a single membrane-spanning region to a short cytoplasmic domain. The extracellular portion of CHL1 is higyly glycosylated and involved them in hemophilic disease.

Références
  • Alevizopoulos A, et al. (1997) Regulation of the Transforming Growth Factor beta-responsive Transcription Factor CTF-1 by Calcineurin and Calcium/ Calmodulin-dependent Protein Kinase IV. The Journal of Biological Chemistry. 272: 23597-605.
  • Gerring SL, et al. (1990) The CHL1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2 / M. EMBO J. 9 (13): 4347-58.
  • Wei MH, et al. (1998) In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Human Genetics. 103 (3): 355-64.
  • Size / Price
    Catalogue : HG10143-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »