After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CHST11 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001173982.1
Taille du ADNc:1059bp
Description du ADNc:Full length Clone DNA of Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 11 with N terminal His tag.
Synonyme du gène:C4ST, C4ST1, C4ST-1, HSA269537, CHST11
Espèces:Human
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11396-ACGCHF270
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11396-ACRCHF270
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11396-CFCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11396-CHCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11396-CMCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11396-CYCHF230
Humain CHST11 Gene cDNA clone plasmidHG11396-MCHF90
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11396-M-FCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11396-NFCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11396-NHCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11396-NMCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11396-NYCHF230
Humain CHST11 / C4ST-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG11396-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

CHST11, also known as C4ST-1, belongs to the sulfotransferase 2 family. CHST11 localizes to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving CHST11 gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia.

Références
  • Hiraoka N. et al., 2000, J Biol Chem. 275 (26): 20188-96.
  • Schmidt HH. et al., 2004, Oncogene. 23 (41): 6991-6.
  • Okuda T. et al., 2001, J Biochem. 128 (5): 763-70.
  • Size / Price
    Catalogue : HG11396-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »