After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CIRBP Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC000403
Taille du ADNc:519bp
Description du ADNc:Full length Clone DNA of Homo sapiens cold inducible RNA binding protein with N terminal Flag tag.
Synonyme du gène:CIRP
Espèces:Human
Vecteur:pCMV3-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14578-ACGCHF270
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14578-ACRCHF270
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14578-ANGCHF270
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14578-ANRCHF270
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14578-CFCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14578-CHCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14578-CMCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14578-CYCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine Gène ADNc clone le vecteur de clonageHG14578-GCHF90
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14578-NFCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14578-NHCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14578-NMCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14578-NYCHF230
Humain CIRBP / Cold-inducible RNA-binding Protéine expression plasmide de Gène l'ADNc ORF cloneHG14578-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

Références
  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • Size / Price
    Catalogue : HG14578-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »