chymase 1 cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

chymase 1 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
744 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 399 C>A not causing the amino acid variation.
Description
Full length Clone DNA of Human chymase 1, mast cell with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.79kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

chymase 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

chymase 1 cDNA ORF Clone, Human, C-HA tag: Validated Images

chymase 1 cDNA ORF Clone, Human, C-HA tag: Alternative Names

chymase cDNA ORF Clone, Human; CYH cDNA ORF Clone, Human; MCT1 cDNA ORF Clone, Human

chymase 1 Background Information

The STR polymorphism in the CMA1 gene is associated with asthma and that this association is even stronger with atopic asthma. CMA1 and IL-4 in atopic asthma and for IL-4 in atopy in general. The local angiotensin II system (LAS) has numerous functions, including the regulation of growth and differentiation in the gastrointestinal tract. Angiotensin II (AngII) may be generated by angiotensin-I-converting enzyme (ACE) or mast cell chymase (CMA1) and plays an important role in inflammatory processes, although opinions differ as to which AngII-generating enzyme is primarily associated with AngII-mediated effects. ACE in the gastric mucosa and the microvasculature of granulation tissue may represent a novel therapeutic target for the promotion of healing processes in gastritis and ulceration using ACE inhibitors or AT1R antagonists. The gene for mast cell chymase (CMA1) is an ideal candidate for investigating genetic predisposition to atopic asthma, as it is an important mediator of inflammation and remodeling in the asthmatic lung. (CMA1) is important for the generation of angiotensin II and therefore might be associated with the pathogenesis of hypertension.
Full Name
chymase 1, mast cell
References
  • Takai S, et al. (2003) Effect of chymase inhibitor on vascular proliferation. Jpn J Pharmacol. 90 (3): 223-7.
  • Caughey GH, et al. (1993) The human mast cell chymase gene (CMA1): mapping to the cathepsin G/granzyme gene cluster and lineage-restricted expression. Genomics. 15 (3): 614-20.
  • Urata H, et al. (1991) Cloning of the gene and cDNA for human heart chymase. J Biol Chem. 266 (26): 17173-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait