Commande rapide

Text Size:AAA

Humain CNDP2 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CNDP2 Informations sur les produits clonés de cDNA
Taille du ADNc:1428bp
Description du ADNc:Full length Clone DNA of Homo sapiens CNDP dipeptidase 2 (metallopeptidase M20 family) with N terminal Myc tag.
Synonyme du gène:CNDP2, CN2, CPGL, PEPA, HsT2298, FLJ10830
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Mouse cytosolic non-specific dipeptidase, also known as CNDP dipeptidase 2, Glutamate carboxypeptidase-like protein 1, Peptidase A, CNDP2 and CN2, is a cytoplasm protein which belongs to the peptidase M20A family. CNDP2 / CPGL is a cytosolic enzyme that can hydrolyze carnosine to yield l-histidine and beta-alanine. CNDP2 / CPGL hydrolyzes a variety of dipeptides including L-carnosine but has a strong preference for Cys-Gly. It may be play a role as tumor suppressor in hepatocellular carcinoma (HCC) cells. Isoform 1 of CNDP2 / CPGL is ubiquitously expressed with higher levels in kidney and liver (at protein level). Isoform 2 of CNDP2 / CPGL is expressed in fetal tissues, it is only expressed in adult liver and placental tissues. CNDP2 / CPGL is highly expressed in the histaminergic neurons in the tuberomammillary nucleus, implying that it may supply histidine to histaminergic neurons for histamine synthesis.

  • Bakker,SJ. et al., 2008, Diabetes  57 (12):e16; author reply e17. 
  • Wanic, K. et al., 2008, Diabetes  57 (9): 2547-51.
  • McDonough,CW. et al., 2009, Hum Genet 126 (2): 265-75.
  • Kaur,H. et al., 2009, J Biol Chem. 284 (21):14493-502.
  • Size / Price
    Catalogue : HG10168-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.