After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain Cochlin expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human COCH Informations sur les produits clonés de cDNA
Taille du ADNc:1653bp
Description du ADNc:Full length Clone DNA of Homo sapiens coagulation factor C homolog, cochlin (Limulus polyphemus) with N terminal His tag.
Synonyme du gène:DFNA9, COCH5B2, COCH-5B2, COCH
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Cochlin, also known as COCH-5B2 and COCH, is a secreted protein which contains one LCCL domain and two VWFA domains. It is an abundant inner ear protein expressed as multiple isoforms. Its function is also unknown, but it is suspected to be an extracellular matrix component. Cochlin and type II collagen are major constituents of the inner ear extracellular matrix, and Cochlin constitutes 70% of non-collagenous protein in the inner ear, the cochlin isoforms can be classified into three subgroups, p63s, p44s and p40s. The expression of cochlin is highly specific to the inner ear. Eleven missense mutation and one in-frame deletion have been reported in the COCH gene, causing hereditary progressive sensorineural hearing loss and vestibular dysfunction, deafness autosomal dominant type 9 (DFNA9). The co-localization of cochlin and type II collagen in the fibrillar substance in the subepithelial area indicate that cochlin may play a role in the structural homeostasis of the vestibule acting in concert with the fibrillar type II collagen bundles. Defects in COCH may contribute to Meniere disease which is an autosomal dominant disorder characterized by hearing loss associated with episodic vertigo.

  • Ikezono T, et al. (2005) Expression of cochlin in the vestibular organ of rats. ORL J Otorhinolaryngol Relat Spec. 67(5): 252-8.
  • Shindo S, et al. (2008) Spatiotemporal expression of cochlin in the inner ear of rats during postnatal development. Neurosci Lett. 444(2): 148-52.
  • Hosokawa S, et al. (2010) Ultrastructural localization of cochlin in the rat cochlear duct. Audiol Neurootol. 15(4): 247-53.
  • Size / Price
    Catalogue : HG11368-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.