Commande rapide

Text Size:AAA

Humain COL5A2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human COL5A2 Informations sur les produits clonés de cDNA
Taille du ADNc:4500bp
Description du ADNc:Full length Clone DNA of Homo sapiens collagen, type V, alpha 2 with N terminal His tag.
Synonyme du gène:COL5A2
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

COL5A2 is a component of type V collagen. It is known as the pro-alpha2(V) chain. COL5A2, together with two pro-alpha1(V) chains can form type V procollagen. These triple-stranded, rope-like procollagen molecules arrange themselves into long, thin fibrils that cross-link to one another in the spaces around cells. The cross-links result in the formation of very strong, mature type V collagen fibers. Type V collagen can be detected in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen.

  • Greenspan DS. et al., 1992, Genomics. 12 (4): 836-7.
  • Mann K. 1992, Biol Chem Hoppe-Seyler. 373 (2): 69-75.
  • Greenspan DS. et al., 1992, Gene Expr. 1 (1): 29-39.
  • Size / Price
    Catalogue : HG13685-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.