Commande rapide

Text Size:AAA

Humain Carboxypeptidase A2/CPA2 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CPA2 Informations sur les produits clonés de cDNA
Taille du ADNc:1254bp
Description du ADNc:Full length Clone DNA of Homo sapiens carboxypeptidase A2 (pancreatic) with N terminal HA tag.
Synonyme du gène:CPA2
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Human Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Size / Price
    Catalogue : HG10499-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.