Commande rapide

Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CRIPT Informations sur les produits clonés de cDNA
Taille du ADNc:306bp
Description du ADNc:Full length Clone DNA of Homo sapiens cysteine-rich PDZ-binding protein with N terminal Flag tag.
Synonyme du gène:HSPC139
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14560-ACGCHF270
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14560-ACRCHF270
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14560-ANGCHF270
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14560-ANRCHF270
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14560-CFCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14560-CHCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14560-CMCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14560-CYCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine Gène ADNc clone le vecteur de clonageHG14560-GCHF90
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14560-NFCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14560-NHCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14560-NMCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14560-NYCHF230
Humain CRIPT / cysteine-rich PDZ-binding Protéine expression plasmide de Gène l'ADNc ORF cloneHG14560-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also interacts strongly with the PDZ3 domain of members of the DLG4 family. It is involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. CRIPT is highly conserved from mammals to plants and binds selectively to the third PDZ domain (PDZ3) of PSD-95 via its C terminus. n heterologous cells, CRIPT causes a redistribution of PSD-95 to microtubules. In brain, CRIPT colocalizes with PSD-95 in the postsynaptic density and can be coimmunoprecipitated with PSD-95 and tubulin. These findings suggest that CRIPT may regulate PSD-95 interaction with a tubulin-based cytoskeleton in excitatory synapses.

  • Niethammer M. et al., 1998,Neuron. 20 (4): 693-707.
  • Passafaro M. et al., 2000, Nat Neurosci. 2 (12): 1063-9.
  • Piserchio A. et al., 2002, J Biol Chem. 277 (9): 6967-73.
  • Fukunaga Y. et al., 2005, J Biochem. 138 (2): 177-82.
  • Size / Price
    Catalogue : HG14560-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.