Placental lactogen cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

Placental lactogen cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
654 bp
Description
Full length Clone DNA of Human chorionic somatomammotropin hormone 1 (placental lactogen) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Placental lactogen cDNA ORF Clone, Human, C-Myc tag: Alternative Names

CS-1 cDNA ORF Clone, Human; CSA cDNA ORF Clone, Human; CSMT cDNA ORF Clone, Human; hCS-1 cDNA ORF Clone, Human; hCS-A cDNA ORF Clone, Human; PL cDNA ORF Clone, Human

Placental lactogen Background Information

Chorionic somatomammotropin hormone, also known as Choriomammotropin, Lactogen, Placental lactogen and CSH1, is a secreted protein which belongs to thesomatotropin / prolactin family. CSH1 is produced only during pregnancy and is involved in stimulating lactation, fetal growth and metabolism. Does not interact with GHR but only activates PRLR through zinc-induced dimerization. The CSH1 gene is member of the GH gene cluster on 17q, which consists of two growth hormone genes and three CSH genes. Genomic alterations in the GH cluster are well known, causing different phenotypes depending on the size of the deletion and the genes involved. The increased prevalence of hemizygosity of CSH1 in population in comparison to controls indicates a role for CSH1 haploinsufficiency in the etiology of growth retardation. Investigation of CSH1 deletions in further SRS and growth retarded patients will enable us to establish under which circumstances haploinsufficiency of CSH1 is likely to result in clinical changes.
Full Name
chorionic somatomammotropin hormone 1 (placental lactogen)
References
  • Prager,S. et al., 2003,Genet Test. 7 (3):259-63.
  • Singleton, DR. et al., 2004, Microbiology. 150 (Pt 2): 285-92.
  • Chen,Y. et al., 2008, Cancer Res. 68 (23):9729-34.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait