After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CSNK1A1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001892.4
Taille du ADNc:1014bp
Description du ADNc:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1.
Synonyme du gène:CK1, HLCDGP1, PRO2975, CSNK1A1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-CSNK1A1
Site de restriction:KpnI + XbaI (6.1kb + 1.01kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1A1 Gene Plasmid Map
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10668-ACGCHF270
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10668-ACRCHF270
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10668-ANGCHF270
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10668-ANRCHF270
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10668-CFCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10668-CHCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10668-CMCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10668-CYCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 Gène ADNc clone le vecteur de clonageHG10668-MCHF90
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10668-M-FCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10668-NFCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10668-NHCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10668-NMCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10668-NYCHF230
Humain CSNK1A1/Casein Kinase 1, alpha 1 expression plasmide de Gène l'ADNc ORF cloneHG10668-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

Références
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Catalogue : HG10668-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »