After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain CTRL-1 / Chymotrypsin-like protease expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CTRL Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC063475
Taille du ADNc:795bp
Description du ADNc:Full length Clone DNA of Homo sapiens chymotrypsin-like with N terminal Myc tag.
Synonyme du gène:CTRL1, MGC70821, CTRL
Espèces:Human
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain CTRL-1 / Chymotrypsin-like protease expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Product nameProduct name
Fond

CTRL-1, also known as chymotrypsin-like protease, belongs to the peptidase S1 family. CTRL-1 contains 1 peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.

Références
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
  • Size / Price
    Catalogue : HG13748-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »