After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CYP2D6 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000106.4
Taille du ADNc:1494bp
Description du ADNc:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
Synonyme du gène:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
Site de restriction:KpnI + XbaI (6.1kb + 1.49kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12022-ACGCHF270
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12022-ACRCHF270
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12022-ANGCHF270
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12022-ANRCHF270
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12022-CFCHF230
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12022-CHCHF260
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12022-CMCHF260
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12022-CYCHF260
Humain CYP2D6/Cytochrome P450 2D6 Gène ADNc clone le vecteur de clonageHG12022-GCHF90
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12022-NFCHF230
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12022-NHCHF230
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12022-NMCHF230
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12022-NYCHF230
Humain CYP2D6/Cytochrome P450 2D6 expression plasmide de Gène l'ADNc ORF cloneHG12022-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG12022-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »