CYP2E1 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

CYP2E1 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Human cytochrome P450, family 2, subfamily E, polypeptide 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CYP2E1 cDNA ORF Clone, Human, C-HA tag: Alternative Names

CPE1 cDNA ORF Clone, Human; CYP2E cDNA ORF Clone, Human; P450-J cDNA ORF Clone, Human; P450C2E cDNA ORF Clone, Human

CYP2E1 Background Information

Cytochrome P45 2E1 (CYP2E1) is an important drug metabolizing enzyme for processing numerous xenobiotics in the liver, including acetaminophen and ethanol. CYP2E1 is an important mediator of RIPF development that functions by increasing cellular ER stress and ROS levels. CYP2E1 metabolizes an extensive array of pollutants, drugs, and other small molecules, often resulting in bioactivation to reactive metabolites. Increased CYP2E1 protein and activity levels can be the main cause of stress-mediated liver damage in diabetes. CYP2E1 gene encodes a drug-metabolizing enzyme that metabolizes mostly small, polar molecules, including toxic laboratory chemicals.
Full Name
cytochrome P450 family 2 subfamily E member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait