Commande rapide

Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain CYP2J2 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC032594
    Taille du ADNc:1509bp
    Description du ADNc:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily J, polypeptide 2 with C terminal Flag tag.
    Synonyme du gène:CPJ2
    Espèces:Human
    Vecteur:pCMV3-C-FLAG
    Plasmid:
    Site de restriction:
    Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CYP2J2 qPCR primers for gene expression analysis, HP103710 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15082-ACGCHF290
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15082-ACRCHF290
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15082-ANGCHF290
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15082-ANRCHF290
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15082-CFCHF260
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15082-CHCHF260
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15082-CMCHF260
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15082-CYCHF260
    Humain CYP2J2/Cytochrome p450 2J2 Gène ADNc clone le vecteur de clonageHG15082-GCHF90
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15082-NFCHF260
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15082-NHCHF260
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15082-NMCHF260
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15082-NYCHF260
    Humain CYP2J2/Cytochrome p450 2J2 expression plasmide de Gène l'ADNc ORF cloneHG15082-UTCHF260
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : HG15082-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »