Commande rapide

Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain CYP3A4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_017460.3
Taille du ADNc:1512bp
Description du ADNc:Full length Clone DNA of Homo sapiens cytochrome P450, family 3, subfamily A, polypeptide 4 with C terminal His tag.
Synonyme du gène:HLP, CP33, CP34, CYP3A, NF-25, CYP3A3, P450C3, P450PCN1, MGC126680, CYP3A4
Espèces:Human
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CYP3A4 qPCR primers for gene expression analysis, HP101577 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12043-ACGCHF290
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12043-ACRCHF290
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12043-ANGCHF290
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12043-ANRCHF290
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12043-CFCHF260
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12043-CHCHF260
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12043-CMCHF260
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12043-CYCHF260
Humain CYP3A4/Cytochrome P450 3A4 Gène ADNc clone le vecteur de clonageHG12043-GCHF90
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12043-NFCHF260
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12043-NHCHF260
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12043-NMCHF260
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12043-NYCHF260
Humain CYP3A4/Cytochrome P450 3A4 expression plasmide de Gène l'ADNc ORF cloneHG12043-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG12043-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »