Commande rapide

Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain CAMK4 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_001744.4
    Taille du ADNc:1422bp
    Description du ADNc:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
    Synonyme du gène:CaMK-GR, MGC36771, CAMK4
    Espèces:Human
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CAMK4 qPCR primers for gene expression analysis, HP100632 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone on other vectors
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10664-ACGCHF270
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10664-ACRCHF270
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10664-ANGCHF270
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10664-ANRCHF270
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10664-CFCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10664-CHCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10664-CMCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10664-CYCHF230
    Humain CaM Kinase 4/CaMKIV Gène ADNc clone le vecteur de clonageHG10664-MCHF90
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10664-M-FCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF cloneHG10664-M-NCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10664-NFCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10664-NHCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10664-NMCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10664-NYCHF230
    Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF cloneHG10664-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

    Références
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Catalogue : HG10664-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »