After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CAMK4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001744.4
Taille du ADNc:1422bp
Description du ADNc:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
Synonyme du gène:CaMK-GR, MGC36771, CAMK4
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10664-ACGCHF270
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10664-ACRCHF270
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10664-ANGCHF270
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10664-ANRCHF270
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10664-CFCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10664-CHCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10664-CMCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10664-CYCHF230
Humain CaM Kinase 4/CaMKIV Gène ADNc clone le vecteur de clonageHG10664-MCHF90
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10664-M-FCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF cloneHG10664-M-NCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10664-NFCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10664-NHCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10664-NMCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10664-NYCHF230
Humain CaM Kinase 4/CaMKIV expression plasmide de Gène l'ADNc ORF cloneHG10664-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

Références
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Catalogue : HG10664-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »