Cystatin F / CST7 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

Cystatin F / CST7 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human cystatin F (leukocystatin) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cystatin F / CST7 cDNA ORF Clone, Human, C-His tag: Alternative Names

CMAP cDNA ORF Clone, Human

Cystatin F / CST7 Background Information

The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms and are divided into three classes. Cystatin F, also known as leukocystatin and CMAP (Cystatin-like Metastasis-Associated Protein), is a type 2 cystatin and its expression is limited to hematopoietic cells, with the highest expression levels being observed in monocytes, dendritic cells, and certain types of T-cells. Furthermore, cystatin F mRNA becomes up-regulated during dendritic cell maturation, and thus suggests a specific role of cystatin F in immune regulation. Cystatin F is produced as a dimer, an inactive cathepsin inhibitor which is activated by chemical reduction. In addition, Cystatin F and its homologues have been observed expressing in various human cancer cell lines established from malignant tumors, and thus indicates a new diagnosis and prevention approach of certain human carcinomas metastasis.
Full Name
cystatin F (leukocystatin)
References
  • Halfon S., et al.,(1998), Leukocystatin, a new class II cystatin expressed selectively by hematopoietic cells. J. Biol. Chem. 273:16400-16408.
  • Ni J., et al., (1998), Cystatin F is a glycosylated human low molecular weight cysteine proteinase inhibitor.J. Biol. Chem. 273:24797-24804.
  • Morita M., et al.,(2000), Genomic construct and mapping of the gene for CMAP (leukocystatin/cystatin F, CST7) and identification of a proximal novel gene, BSCv (C20orf3).Genomics 67:87-91.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait