After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human DBH Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC017174
Taille du ADNc:1812bp
Description du ADNc:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with C terminal HA tag.
Synonyme du gène:DBM, DBH
Espèces:Human
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13440-ACGCHF290
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13440-ACRCHF290
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG13440-ANGCHF290
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG13440-ANRCHF290
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13440-CFCHF260
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13440-CHCHF260
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13440-CMCHF260
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13440-CYCHF260
Humain DBH / Dopamine beta-Hydroxylase Gène ADNc clone le vecteur de clonageHG13440-GCHF90
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13440-NFCHF260
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13440-NHCHF260
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13440-NMCHF260
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13440-NYCHF260
Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF cloneHG13440-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

Références
  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • Size / Price
    Catalogue : HG13440-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »