Commande rapide

Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain DBH Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC017174
    Taille du ADNc:1812bp
    Description du ADNc:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with N terminal HA tag.
    Synonyme du gène:DBM, DBH
    Espèces:Human
    Vecteur:pCMV3-N-HA
    Plasmid:
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DBH qPCR primers for gene expression analysis, HP102142 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13440-ACGCHF290
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13440-ACRCHF290
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG13440-ANGCHF290
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG13440-ANRCHF290
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13440-CFCHF260
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13440-CHCHF260
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13440-CMCHF260
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13440-CYCHF260
    Humain DBH / Dopamine beta-Hydroxylase Gène ADNc clone le vecteur de clonageHG13440-GCHF90
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13440-NFCHF260
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13440-NHCHF260
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13440-NMCHF260
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13440-NYCHF260
    Humain DBH / Dopamine beta-Hydroxylase expression plasmide de Gène l'ADNc ORF cloneHG13440-UTCHF260
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

    Références
  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »