Commande rapide

Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human DDC Informations sur les produits clonés de cDNA
Taille du ADNc:1443bp
Description du ADNc:Full length Clone DNA of Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) with N terminal Flag tag.
Synonyme du gène:AADC
Site de restriction:HindIII + XbaI (6kb + 1.48kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human DDC Gene Plasmid Map
Human DDC natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10560-ACGCHF270
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10560-ACRCHF270
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10560-ANGCHF270
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10560-ANRCHF270
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10560-CFCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10560-CHCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10560-CMCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10560-CYCHF230
Humain DOPA Decarboxylase/DDC Gène ADNc clone le vecteur de clonageHG10560-MCHF90
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF cloneHG10560-M-NCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10560-NFCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10560-NHCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10560-NMCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10560-NYCHF230
Humain DOPA Decarboxylase/DDC expression plasmide de Gène l'ADNc ORF cloneHG10560-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Catalogue : HG10560-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human DDC natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.