After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain ARHI / DIRAS3 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human DIRAS3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC005362
Taille du ADNc:690bp
Description du ADNc:Full length Clone DNA of Homo sapiens DIRAS family, GTP-binding RAS-like 3.
Synonyme du gène:ARHI, NOEY2, DIRAS3
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, ARHI is not only an important factor in the pathogenesis of gastric cancer, but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease.

Références
  • Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24.
  • Lin D. et al., 2011, J Int Med Res. 39 (5): 1870-5.
  • Wang W. et al., 2012, Oncol Rep. 27 (6): 1953-9.
  • Size / Price
    Catalogue : HG14239-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »