Commande rapide

Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human DPYS Informations sur les produits clonés de cDNA
Taille du ADNc:1561bp
Description du ADNc:Full length Clone DNA of Homo sapiens dihydropyrimidinase with N terminal Myc tag.
Synonyme du gène:DHP, DHPase
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14884-ACGCHF290
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14884-ACRCHF290
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14884-ANGCHF290
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14884-ANRCHF290
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14884-CFCHF260
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14884-CHCHF260
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14884-CMCHF260
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14884-CYCHF260
Humain DPYS / Dihydropyrimidinase Gène ADNc clone le vecteur de clonageHG14884-GCHF90
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14884-NFCHF260
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14884-NHCHF260
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14884-NMCHF260
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14884-NYCHF260
Humain DPYS / Dihydropyrimidinase expression plasmide de Gène l'ADNc ORF cloneHG14884-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Catalogue : HG14884-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.