Commande rapide

Text Size:AAA

Humain RCAS1 / EBAG9 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human EBAG9 Informations sur les produits clonés de cDNA
Taille du ADNc:642bp
Description du ADNc:Full length Clone DNA of Homo sapiens estrogen receptor binding site associated, antigen, 9 with C terminal His tag.
Synonyme du gène:EB9, PDAF, RCAS1, EBAG9
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

RCAS1, also known as EBAG9, is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. RCAS1 gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor which binds to the estrogen-responsive element (ERE) found in the 5'-flanking region of RCAS1 gene. Two transcript variants differing in the 5' UTR, but encoding the same protein, have been identified for RCAS1 gene. EBAG9 may participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.

  • Ohshima K. et al., 2001, Clin Exp Immunol. 123 (3): 481-6.
  • Ikeda K. et al., 2000, Biochem Biophys Res Commun. 273 (2): 654-60.
  • Nakashima M. et al., 1999, Nat Med. 5 (8): 938-42.
  • Size / Price
    Catalogue : HG14012-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.