Commande rapide

Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain EBP Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_006579.2
    Taille du ADNc:693bp
    Description du ADNc:Full length Clone DNA of Homo sapiens emopamil binding protein (sterol isomerase) with N terminal HA tag.
    Synonyme du gène:CPX, CHO2, CPXD, CDPX2
    Espèces:Human
    Vecteur:pCMV3-N-HA
    Plasmid:
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EBP qPCR primers for gene expression analysis, HP105158 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG16409-ACGCHF270
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG16409-ACRCHF270
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG16409-ANGCHF270
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG16409-ANRCHF270
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG16409-CFCHF230
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG16409-CHCHF230
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG16409-CMCHF230
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG16409-CYCHF230
    Humain emopamil binding Protéine Gène ADNc clone le vecteur de clonageHG16409-GCHF90
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG16409-NFCHF230
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG16409-NHCHF230
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG16409-NMCHF230
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG16409-NYCHF230
    Humain emopamil binding Protéine expression plasmide de Gène l'ADNc ORF cloneHG16409-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : HG16409-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »