Commande rapide

Text Size:AAA

Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ECD Informations sur les produits clonés de cDNA
Taille du ADNc:1935bp
Description du ADNc:Full length Clone DNA of Homo sapiens ecdysoneless homolog (DrosophilA) with N terminal Myc tag.
Synonyme du gène:GCR2, HSGT1, ECD
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14311-ACGCHF290
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14311-ACRCHF290
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG14311-ANGCHF290
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG14311-ANRCHF290
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14311-CFCHF260
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14311-CHCHF260
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14311-CMCHF260
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14311-CYCHF260
Humain ECD / Ecdysoneless homolog Gène ADNc clone le vecteur de clonageHG14311-GCHF90
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14311-NFCHF260
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14311-NHCHF260
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14311-NMCHF260
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14311-NYCHF260
Humain ECD / Ecdysoneless homolog expression plasmide de Gène l'ADNc ORF cloneHG14311-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in muscle and heart. ECD is a novel promoter of mammalian cell cycle progression. This function is related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. It is a novel tumor-promoting factor that is differentially expressed in pancreatic cancer and potentially regulates glucose metabolism within cancer cells. ECD may also be a transcriptional activator required for the expression of glycolytic genes.

  • Badzek S. et al., 2011, Wien Klin Wochenschr. 123 (23-24): 726-31.
  • Zhao X. et al., 2012, Breast Cancer Res Treat. 134 (1): 171-80.
  • Dey P. et al., 2012, Clin Cancer Res. 18 (22): 6188-98.
  • Size / Price
    Catalogue : HG14311-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.