Commande rapide

Humain EDNRB / Endothelin B Receptor expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

  • Ferret CD3e/CD3 epsilon Gene Plasmid Map 5630
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain EDNRB Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC014472
Taille du ADNc:1344 bp
Description du ADNc:Full length Clone DNA of Homo sapiens endothelin receptor type B with N terminal Myc tag.
Synonyme du gène:ETB, ET-B, ETBR, ETRB, HSCR, WS4A, ABCDS, ET-BR, HSCR2
Espèces:Human
Vecteur:pCMV3-SP-N-Myc
Plasmid:pCMV3-SP-Myc-EDNRB
Site de restriction:KpnI + XbaI(6kb+1.34kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with EDNRB qPCR primers for gene expression analysis, HP104096 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain EDNRB / Endothelin B Receptor expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Product nameProduct name
Size / Price
Catalogue : HG15473-NM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »