After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human EEF1B2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC000211
Taille du ADNc:678bp
Description du ADNc:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 beta 2 with C terminal HA tag.
Synonyme du gène:EF1B, EEF1B, EEF1B1
Espèces:Human
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain EF1B / EEF1B2 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Product nameProduct name
Fond

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

Références
  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Catalogue : HG14611-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »