After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Ephrin-A4/EFNA4 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human EFNA4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005227
Taille du ADNc:606bp
Description du ADNc:Full length Clone DNA of Homo sapiens ephrin-A4 with N terminal Flag tag.
Synonyme du gène:LERK4
Espèces:Human
Vecteur:pCMV3-SP-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

EPH-related receptor tyrosine kinase ligand 4 (Ephrin-A4) also known as EFNA4, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A4/EFNA4 functions as a cell surface GPI-bound ligand for Eph receptor, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development.

Références
  • Aasheim HC, et al. (2000) A splice variant of human ephrin-A4 encodes a soluble molecule that is secreted by activated human B lymphocytes. Blood. 95(1): 221-30.
  • Moss A, et al. (2005) Ephrin-A4 inhibits sensory neurite outgrowth and is regulated by neonatal skin wounding. Eur J Neurosci. 22(10): 2413-21.
  • Cerretti DP, et al. (1998) Characterization of the genes for mouse LERK-3/Ephrin-A3 (Epl3), mouse LERK-4/Ephrin-A4 (Epl4), and human LERK-6/Ephrin-A2 (EPLG6): conservation of intron/exon structure. Genomics. 47(1): 131-5.
  • Size / Price
    Catalogue : HG12087-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »