eIF2alpha / EIF2S1 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

eIF2alpha / EIF2S1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
993 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.99kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

eIF2alpha / EIF2S1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2alpha / EIF2S1 cDNA ORF Clone, Human, C-His tag: Validated Images

eIF2alpha / EIF2S1 cDNA ORF Clone, Human, C-His tag: Alternative Names

EIF-2 cDNA ORF Clone, Human; EIF-2A cDNA ORF Clone, Human; EIF-2alpha cDNA ORF Clone, Human; EIF2 cDNA ORF Clone, Human; EIF2A cDNA ORF Clone, Human

eIF2alpha / EIF2S1 Background Information

Full Name
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait