EIF5A2 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

EIF5A2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
462 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 5A2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EIF5A2 cDNA ORF Clone, Human, untagged: Alternative Names

EIF-5A2 cDNA ORF Clone, Human; eIF5AII cDNA ORF Clone, Human

EIF5A2 Background Information

Eukaryotic translation initiation factor 5A2 (EIF5A2) has been demonstrated to be upregulated in numerous types of human cancer and is associated with cancer progression. Silencing of EIF5A2 in the NSCLC cells resulted in the downregulation of the tumorigenic proteins, apoptosis regulator Bcl-2 and myc proto-oncogene protein, and upregulation of E-cadherin, suggesting that EIF5A2 promotes proliferation and metastasis through these proteins. EIF5A2 may therefore serve as a novel therapeutic target for the treatment of NSCLC. EIF5A2 might be a novel therapeutic target for the inhibition of NPC progress. EIF5A2 overexpression may contribute to cancer progression and poor prognosis, it could be a novel potential prognostic marker for FIGO stage I-II cervical cancer. EIF5A2 upregulation plays an important oncogenic role in gastric cancer. EIF5A2 may represent a new predictor for poor survival and is a potential therapeutic target for gastric cancer. The eukaryotic initiation factor 5A2 (EIF5A2) over-expression enhances HCC cell metastasis. EIF5A2, as a target of PI3K/Akt, promotes melanoma cell invasion and may serve as a promising prognostic marker and a potential therapeutic target for melanoma.
Full Name
eukaryotic translation initiation factor 5A2
Add to Cart Successfully Add to Cart Failed