After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain ENO3 / beta-enolase expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ENO3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC017249
Taille du ADNc:1305bp
Description du ADNc:Full length Clone DNA of Homo sapiens enolase 3 (beta, muscle).
Synonyme du gène:GSD13, MSE, ENO3
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain ENO3 / beta-enolase expression plasmide de Gène l'ADNc ORF clone on other vectors
Product nameProduct name
Fond

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

Références
  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • Size / Price
    Catalogue : HG14270-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »