Commande rapide

Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

  • Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
  • Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain EPOR Informations sur les produits clonés de cDNA
Taille du ADNc:1008bp
Description du ADNc:Full length Clone DNA of Homo sapiens erythropoietin receptor, transcript variant 2 with C terminal Flag tag.
Synonyme du gène:EPO-R, MGC138358, EPOR
Site de restriction:KpnI + XbaI (6kb + 1.06kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
( We provide with EPOR qPCR primers for gene expression analysis, HP100065 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain EPOR Gene Plasmid Map
Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Humain EPOR Gene Expression validated Image
Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
[Cliquer pour agrandir l’image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13305-ACGCHF270
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13305-ACRCHF270
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13305-CFCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13305-CHCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13305-CMCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13305-CYCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 Gène ADNc clone le vecteur de clonageHG13305-GCHF90
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13305-NFCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13305-NHCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13305-NMCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13305-NYCHF230
Humain EPOR/Erythropoietin Receptor transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG13305-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and liver in an oxygen-dependent manner. The biological effects of EPO are mediated by the specific erythropoietin receptor (EPOR/EPO Receptor) on bone marrow erythroblasts, which transmits signals important for both proliferation and differentiation along the erythroid lineage. EPOR protein is a type â…  single-transmembrane cytokine receptor, and belongs to the homodimerizing subclass which functions as ligand-induced or ligand-stabilized homodimers. EPOR signaling prevents neuronal death and ischemic injury. Recent studies have shown that EPO and EPOR protein may be involved in carcinogenesis, angiogenesis, and invasion.

  • Divoky V, et al. (2002) Mouse surviving solely on human erythropoietin receptor (EpoR): model of human EpoR-linked disease. Blood 99(10): 3873-4.
  • Carruthers SG. (2009) A truncated erythropoietin receptor EPOR-T is associated with hypertension susceptibility. Clin Pharmacol Ther. 86(2): 134-6.
  • Baltaziak M, et al. (2009) Relationships of P53 and Bak with EPO and EPOR in human colorectal cancer. Anticancer Res. 29(10):4151-6.
  • Size / Price
    Catalogue : HG13305-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.