After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Esterase D/ESD expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ESD Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC001169
Taille du ADNc:849bp
Description du ADNc:Full length Clone DNA of Homo sapiens esterase D.
Synonyme du gène:RP11-147L20.1, FGH, FLJ11763, ESD
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain Esterase D/ESD expression plasmide de Gène l'ADNc ORF clone on other vectors
Product nameProduct name
Fond

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

Références
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • Size / Price
    Catalogue : HG14252-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »